View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6015_low_15 (Length: 272)
Name: NF6015_low_15
Description: NF6015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6015_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 92 - 263
Target Start/End: Original strand, 3594977 - 3595171
Alignment:
| Q |
92 |
gtatttttctgctatctggcctgggagggaagtcttttctgtttgtg-------------ttttattggggggttttcttgtctgctgtttgtgcccccc |
178 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594977 |
gtatttttctgctatctggtctgggagggaagtcttttctgtttgtgaggcccgtttgtgttttattggggggttttcttgtctgctgtttgtgcccccc |
3595076 |
T |
|
| Q |
179 |
nnnnnnnctggtttt----------atggttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgttgtttttgctggcctttgc |
263 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3595077 |
attttttctggtttttggtggttttatagttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgttgtttttgctggcctttgc |
3595171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 3594712 - 3594793
Alignment:
| Q |
19 |
ctctctggattcacagcggttttgttggttttttaaggcggctgttcagctatttttagtagtgctgctgggagtatttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3594712 |
ctctctggattcacagcggttttgttggttttttaaggcggctgttcagctatttttagtagtgctgctggtagtatttttc |
3594793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 187 - 263
Target Start/End: Original strand, 5179654 - 5179730
Alignment:
| Q |
187 |
tggttttatggttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgttgtttttgctggcctttgc |
263 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
5179654 |
tggttttatggttggggtgttccgcctatatacggcaccctgtttgattttgtactgttgtttttgctggcctttgc |
5179730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 138
Target Start/End: Original strand, 32017317 - 32017361
Alignment:
| Q |
95 |
tttttctgctatctggcctggg-agggaagtcttttctgtttgtg |
138 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
32017317 |
tttttctgctatctggcctgggaagggaggtctttgctgtttgtg |
32017361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 263
Target Start/End: Original strand, 23352973 - 23353051
Alignment:
| Q |
186 |
ctggttttatggttggggtgtgccgcctatagaaggcaccctgttt-gtttttatattgttgtttttgctggcctttgc |
263 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| | ||||||| ||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
23352973 |
ctggttttttggttggggtgttccgcctatatacggcacccgattttgtttttctattgttgtttttgatggcctttgc |
23353051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University