View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6015_low_17 (Length: 257)
Name: NF6015_low_17
Description: NF6015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6015_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 32 - 239
Target Start/End: Original strand, 14826191 - 14826398
Alignment:
| Q |
32 |
tcatctgctattattagtatacgaaaagaagcattgacttattattatcgtgatcatagtataaagtcgttcttttatggatagtactattctgtgacta |
131 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14826191 |
tcatttgctattattagtatacgaaaagaagcattgacttattattatcgtgatcatagtataaagtcgttcttttatggatagtactattctgtgacta |
14826290 |
T |
|
| Q |
132 |
atgattatagtgcacatgcagtttatggtgtttgcttgctcagattctagagtatgcccttcccacattttggatttccaaccgggtgaagcctttgtgg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14826291 |
atgattatagtgcacatgcagtttatggtgtttgcttgctcagattctagagtatgcccttcccacattttggatttccaaccgggtgaagcctttgtgg |
14826390 |
T |
|
| Q |
232 |
tccgtaac |
239 |
Q |
| |
|
|||||||| |
|
|
| T |
14826391 |
tccgtaac |
14826398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University