View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_high_16 (Length: 418)
Name: NF6016_high_16
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 17 - 406
Target Start/End: Original strand, 52797461 - 52797850
Alignment:
| Q |
17 |
aaagtgcaaatggaactaaggagcaaaataagctctgataggaaaatggaagaaaaggacatagagagtcttccatacctcaaagcagttatcaaggaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797461 |
aaagtgcaaatggaactaaggagcaaaataagctctgataggaaaatggaagaaaaggacatagagagtcttccatacctcaaagcagttatcaaggaga |
52797560 |
T |
|
| Q |
117 |
cgttgagactccacccacctcttccttttttggttcctcacatggccatggactcttgcatgattggagactacttcattccaaaagagacacaaatttt |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797561 |
cgttgagacttcacccacctcttccttttttggttcctcacatggccatggactcttgcatgattggagactacttcattccaaaagagacacaaatttt |
52797660 |
T |
|
| Q |
217 |
agtgaatgtttgggcaattgggagggatccaaaagtgtgggatgctcccttattgttctggccagaaaggtttatgcagccaaacatggtagattacaaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797661 |
agtgaatgtttgggcaattgggagggatccaaaagtgtgggatgctcccttattgttctggccagaaaggtttatgcagccaaacatggtagattacaaa |
52797760 |
T |
|
| Q |
317 |
ggacaccattttgagtatataccttttggttcgggtcggagaatgtgcccggcattgccgcttgcctcgcgtgtgcttccactggcccta |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797761 |
ggacaccattttgagtatataccttttggttcgggtcgaagaatgtgcccggcattgccgcttgcctcgcgtgtgcttccactggcccta |
52797850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University