View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_high_37 (Length: 255)
Name: NF6016_high_37
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 85 - 240
Target Start/End: Original strand, 884091 - 884246
Alignment:
| Q |
85 |
aagagcatatctaatgttaattgagtaactgattataatcccctcactaattaataatttttgttactaaatcaaaatgaatgaaaatgaaagatggttt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
884091 |
aagagcatatctaatgttaattgagtaactgattataatcccctcactaattaataatttttgttactaaatcaaaatgaatgaaaatgaaagatggttt |
884190 |
T |
 |
| Q |
185 |
agaaggtgtgggaaacgagttgacgtgtatttgagtagattacagataagacatgt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
884191 |
agaaggtgtgggaaacgagttgacgtgtatttgagtagattacagataagacatgt |
884246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University