View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_high_43 (Length: 237)
Name: NF6016_high_43
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 46549800 - 46550004
Alignment:
| Q |
1 |
ttaaattatgaaacttctattggtctggttattgggagtggtgctaagttgagatcataagggatgaagtttatgtgttacagcaagtaggtaataaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
46549800 |
ttaaattatgaaacttctattggtctggttattgggagtggtgctaagttgagatcataagggatgatgtttaggtgttacagcaagtaggtaataaata |
46549899 |
T |
 |
| Q |
101 |
ttttgctatggagggtggtgaatattcatgcctcaaatttgcatgaattgctgttctcggtatttgacttttagttaagcaggacgtagttttgaatcga |
200 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46549900 |
ttttgctatggtgggtggtaaatattcatgcctcatatttgcatgaattgctgttctcggtatttgacttttagttaagcaggacgtagttttgaatcga |
46549999 |
T |
 |
| Q |
201 |
atcat |
205 |
Q |
| |
|
||||| |
|
|
| T |
46550000 |
atcat |
46550004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University