View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_high_45 (Length: 234)
Name: NF6016_high_45
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_high_45 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 56 - 234
Target Start/End: Complemental strand, 46549582 - 46549404
Alignment:
| Q |
56 |
aaatttggtgtagttatagtcactccaaactttatagtagatcaatcctgcacatcattcattgnnnnnnnnnnnnnnnnnggcttgtgataactataaa |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46549582 |
aaatttggtgtagttatagtcactccaaactttatagtagatcaatcctgcacatcattcattgttttttattttacttttggcttgtgataactataaa |
46549483 |
T |
 |
| Q |
156 |
catttattttatggatcccaaaatcccacatttcaccatatgcaaaaactttaatgggtcactctctaaaacattgacc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46549482 |
catttattttatggatcccaaaatcccacatttcaccatatgcaaaaactttaatgggtcactctctaaaacattgacc |
46549404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University