View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_high_46 (Length: 220)
Name: NF6016_high_46
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_high_46 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 38473862 - 38473657
Alignment:
| Q |
1 |
atcacgatgttcttccaagtatatacatggagatgtgtctatcactgtctcaatgacatggctccgtttcttattgatgtgcagatgttagtgtgtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||| || | |
|
|
| T |
38473862 |
atcacgatgttcttccaagtatatacatggagatgtgtctatcactgtctcaatgacatggctccgttccttattgatatgcagatgttaatgt-aaata |
38473764 |
T |
|
| Q |
101 |
ttagattttgggttgtcacgtctacacattcgtaaggacggtgatcatgttgttgtgtcggatgacaataattgagtttaataattggtttaatgtatca |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| | |
|
|
| T |
38473763 |
ttagattttgggttgtcacatctacacattcataagaacggtgatcatgttgttgtgttggatgacactaattgagtttaataattggtttaatatatta |
38473664 |
T |
|
| Q |
201 |
tttggtc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
38473663 |
tttggtc |
38473657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 220
Target Start/End: Complemental strand, 41516467 - 41516432
Alignment:
| Q |
185 |
ttggtttaatgtatcatttggtctcttaacttattt |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41516467 |
ttggtttaatatatcatttggtctcttaacttattt |
41516432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 187 - 220
Target Start/End: Complemental strand, 32894918 - 32894885
Alignment:
| Q |
187 |
ggtttaatgtatcatttggtctcttaacttattt |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
32894918 |
ggtttaatgtatcatttggtcccttaacttattt |
32894885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University