View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_low_24 (Length: 306)
Name: NF6016_low_24
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 103 - 289
Target Start/End: Original strand, 14020836 - 14021022
Alignment:
| Q |
103 |
tgcaggtgtgtgtgctaaaacgacattgatgctttcgagaacaactgtcataaaatggagtgtttcaatatatagacaaacaaaattaaaactagatggg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14020836 |
tgcaggtgtgtgtgctaaaacgacattgatgctttcgagaacaactgtcataaaatggagtgtttcaatatatagacaaacaaaattaaaactagatggg |
14020935 |
T |
 |
| Q |
203 |
tcatctatttttagcttcattatcaattcatcatcataaatctcatattcttaaatcttaacctcactccaaatccaaaaatgcatt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14020936 |
tcatctatttttagcttcattatcaattcatcatcataaatctcatattcttaaatcttaacctcactccaaatccaaaaatgcatt |
14021022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 14020734 - 14020770
Alignment:
| Q |
1 |
tccaggtgtgtgaaaagagccaaaaaggttttgccat |
37 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14020734 |
tccaggtgtgtggaaagagccaaaaaggttttgccat |
14020770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University