View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_low_26 (Length: 300)
Name: NF6016_low_26
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 22 - 281
Target Start/End: Complemental strand, 32506494 - 32506235
Alignment:
| Q |
22 |
ccgagaggcgaacgcgtctgtctctcggccctttcgccgtgcaaactttactatgacgatcttttcgacctcttgaccttataatgtgacctccgtcaac |
121 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506494 |
ccgagagacgaacgcgtctgtctctcggccctttcgccgtgcaaactttactatgacgatcttttcgacctcttgaccttataatgtgacctccgtcaac |
32506395 |
T |
 |
| Q |
122 |
ttccactatctctccaccgttcattgctcctccataatccaaaccactagaactagaacgacaccgttttttggtttgtgttaacggaagaacgtttcct |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506394 |
ttccactatttctccaccgttcattgctcctccataatccaaaccactagaactagaacgacaccgttttttggtttgtgttaacggaagaacgtttcct |
32506295 |
T |
 |
| Q |
222 |
tcagttaaatttactacatgtttttggtttaataatacgacatcgttttgatgagggtgt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32506294 |
tcagttaaatttactacatgtttttggtttaataatacgacatcgttctgatgagggtgt |
32506235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University