View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_low_28 (Length: 287)
Name: NF6016_low_28
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 44952470 - 44952647
Alignment:
| Q |
16 |
cacatacttcactttgttcattggtcctaacacgggtcttgcgcccctcgtaggcctagactattctaatatatgtatagtgttataacatgctcgagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952470 |
cacatacttcactttgttcattggtcctaacacgggtcttgcgcccctcgtaggcctagactattctaatatatgtatagtgttataacatgctcgagat |
44952569 |
T |
 |
| Q |
116 |
tagataacgtctcacttggacacgactcgacgcacatacattttcatacagatgatactttacttcaaatatgtaaat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
44952570 |
tagataacgtctcacttggacacgactcgacgcacatacattttgacaaagatgatactttacttcaaatatgtaaat |
44952647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 185 - 279
Target Start/End: Original strand, 44953379 - 44953473
Alignment:
| Q |
185 |
tatgtaaattacacttaaataattcacatcaacataatatagtcacatattcacttagaaagctaaacaatcacagactttaatttagaataata |
279 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44953379 |
tatgtaaattacacttaaagaattcacatcaacataatatagtcacatattcacttagaaagctaaacaatcacatactttaatttagaataata |
44953473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University