View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6016_low_41 (Length: 241)
Name: NF6016_low_41
Description: NF6016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6016_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 224
Target Start/End: Original strand, 27755816 - 27756031
Alignment:
| Q |
9 |
caagaaaatcgaagcattgaccttaggtttaccattaatattcctcgacgacccttccaagaagtttggtgctagggtttcaagctatgaggatctgatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27755816 |
caagaaaatcgaagcattgaccttaggtttaccattaatattactcgacgacccttccaagaagtttggtgctagggtttcaagctatgaggatctgatc |
27755915 |
T |
|
| Q |
109 |
agggagtcatacaatagctccgatgatattccggtgaacagagatgtgtctcaatccgacgtggcggcgattctttactcttcaggcacaacggggagaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27755916 |
agggagtcatacaatagctccgatgatattccggtgaacagagatgtgtctcaatccgacgtggcggcgattctttactcttcaggcacaacggggagaa |
27756015 |
T |
|
| Q |
209 |
gcaagggagtgatgct |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27756016 |
gcaagggagtgatgct |
27756031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 222
Target Start/End: Original strand, 27766639 - 27766701
Alignment:
| Q |
160 |
caatccgacgtggcggcgattctttactcttcaggcacaacggggagaagcaagggagtgatg |
222 |
Q |
| |
|
|||||||||||||||| |||||| || || |||||||| ||||||| ||| |||||||||||| |
|
|
| T |
27766639 |
caatccgacgtggcggtgattctgtattcctcaggcaccacggggaaaagtaagggagtgatg |
27766701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University