View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6017_high_10 (Length: 259)
Name: NF6017_high_10
Description: NF6017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6017_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 7061860 - 7061630
Alignment:
| Q |
14 |
aatattaccccactttttgctttccgttgctttcaatcacaaatatcaaatcaaattatctgcatagtctatttaagagaagatttgggttgggtactcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7061860 |
aatattaccccactttttgctttccgttgctttcgatcacaaatatcaaatcaaattatctgcatagtctatttaagagaagatttgggttgggtactcc |
7061761 |
T |
 |
| Q |
114 |
acttcttatttatttatttattttcatccgttgtctcttatgtaagaatattgaattgaataattcttgtgatctttttacacacggcaaactcaagatt |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7061760 |
acttcttattt--------attttcatccgttgtctcttatgtaagaatattgaattgaataattcttgtgatc-ttttacacacggcaaactcaagatt |
7061670 |
T |
 |
| Q |
214 |
aattgtatatg-tttagcttatttattctttcctatgctt |
252 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
7061669 |
aattgtatatgttttagcttatttattctttcctaggctt |
7061630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University