View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6017_high_12 (Length: 240)
Name: NF6017_high_12
Description: NF6017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6017_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 36693735 - 36693959
Alignment:
| Q |
1 |
aaatcttagatgttgcaatgtgagtttctgctgaggttggtggaaccattttgtggattgatattgataattgctttaaagcttttccagtttccatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36693735 |
aaatcttagatgttgcaatgtgagtttctgctgaggttggtggagccattttgtggattgatattgataattgctttaaagcttttccagtttccatgct |
36693834 |
T |
 |
| Q |
101 |
catcttaatgcatggttcttgtattttgcttttgatttcctttggtgtctatnnnnnnngtttaacatattaaaaaataagtcattaatttctccaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||| ||| || |
|
|
| T |
36693835 |
catcttaatgcatggttcttgtattttgcttttgatttcctttggtgtctataaaaaaagtgtaacatattaaaatataagtcattaatttctacaaaaa |
36693934 |
T |
 |
| Q |
201 |
atactaaactttacaataaaaatat |
225 |
Q |
| |
|
||||| |||||| |||||||||||| |
|
|
| T |
36693935 |
atactgaactttgcaataaaaatat |
36693959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University