View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6017_low_11 (Length: 252)
Name: NF6017_low_11
Description: NF6017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6017_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 42408923 - 42409029
Alignment:
| Q |
13 |
aatatagtaagcacccaacgaagaaccatatcagcatttgaagctcgaatctcactcattttcgctctcgcttctcaatccgcctctctatcccagcgac |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42408923 |
aatagagtaagcacccaacgaagaaccatatcagcatttgaagctcgaatctcactcattttcgctctcgcttctcaatccttctctctatcccagcgac |
42409022 |
T |
 |
| Q |
113 |
gtaaatg |
119 |
Q |
| |
|
||||||| |
|
|
| T |
42409023 |
gtaaatg |
42409029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 42409095 - 42409144
Alignment:
| Q |
185 |
catgatgcagttgttgctgatgtggctaccgagactgcaaagtacttgtt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42409095 |
catgatgcagttgttgctgatgtggctaccgagactgcaaagtacttgtt |
42409144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University