View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6017_low_11 (Length: 252)

Name: NF6017_low_11
Description: NF6017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6017_low_11
NF6017_low_11
[»] chr7 (2 HSPs)
chr7 (13-119)||(42408923-42409029)
chr7 (185-234)||(42409095-42409144)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 42408923 - 42409029
Alignment:
13 aatatagtaagcacccaacgaagaaccatatcagcatttgaagctcgaatctcactcattttcgctctcgcttctcaatccgcctctctatcccagcgac 112  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
42408923 aatagagtaagcacccaacgaagaaccatatcagcatttgaagctcgaatctcactcattttcgctctcgcttctcaatccttctctctatcccagcgac 42409022  T
113 gtaaatg 119  Q
    |||||||    
42409023 gtaaatg 42409029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 42409095 - 42409144
Alignment:
185 catgatgcagttgttgctgatgtggctaccgagactgcaaagtacttgtt 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
42409095 catgatgcagttgttgctgatgtggctaccgagactgcaaagtacttgtt 42409144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University