View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6017_low_7 (Length: 330)
Name: NF6017_low_7
Description: NF6017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6017_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 156 - 323
Target Start/End: Complemental strand, 40963907 - 40963740
Alignment:
| Q |
156 |
atcctcattagctggaattataagctgcatagtgaaactgttcagtggtcttagttaaaatattgctaaaaccacgttatctaattttcttgcctaagat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40963907 |
atcctcattagctggaattataagctgcatagtgaaactgttcagtggtcttagttaaaatattgctaaaaccacgttatctaattttcttgcctaagat |
40963808 |
T |
|
| Q |
256 |
acctgtggcttgcaagatgttaaacatgacaaatcaaaatctgttaaagacacatgcccatttctctg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40963807 |
acctgtggcttgcaagatgttaaacatgacaaatcaaaatctgttaaagacacatgcccatttctctg |
40963740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 19 - 125
Target Start/End: Complemental strand, 40964044 - 40963938
Alignment:
| Q |
19 |
gaggaaatacaaaccggagctatgtactcttctgtaccaacaaaagaattggacgctctcattggttccgccataaacgttggaatttgttgagttttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40964044 |
gaggaaatacaaaccggagctatgtactcttctgtaccaacaaaagaattggacgctctcattggttccgccataaacgttggaatttgttgagttttct |
40963945 |
T |
|
| Q |
119 |
gttgtcc |
125 |
Q |
| |
|
||||||| |
|
|
| T |
40963944 |
gttgtcc |
40963938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 27 - 95
Target Start/End: Complemental strand, 22799604 - 22799536
Alignment:
| Q |
27 |
acaaaccggagctatgtactcttctgtaccaacaaaagaattggacgctctcattggttccgccataaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
22799604 |
acaaaccggagctatgtactcttctgtgccaacaaaagaatttgatgctctcattggttcagccataaa |
22799536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 252 - 323
Target Start/End: Complemental strand, 22799387 - 22799316
Alignment:
| Q |
252 |
agatacctgtggcttgcaagatgttaaacatgacaaatcaaaatctgttaaagacacatgcccatttctctg |
323 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
22799387 |
agatacctgtggtttgcaagatgttaaacaggacaaatcaaaatctgttagagacacatgtccacttctctg |
22799316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 317
Target Start/End: Complemental strand, 19591987 - 19591919
Alignment:
| Q |
249 |
ctaagatacctgtggcttgcaagatgttaaacatgacaaatcaaaatctgttaa-agacacatgcccatt |
317 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| ||||| ||||||||| || ||||||||| ||||| |
|
|
| T |
19591987 |
ctaaaatacctgtggtttgcaagatgttaaacatgccaaat-aaaatctgtcaagagacacatgtccatt |
19591919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University