View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6018_low_4 (Length: 251)
Name: NF6018_low_4
Description: NF6018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6018_low_4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 251
Target Start/End: Complemental strand, 779510 - 779281
Alignment:
| Q |
22 |
agattaatgcatgtaatctctacaaatttcgtaaggagacaagataaaattgataacgtgaaacttacctttcaacttgtgcattttatcacactccgac |
121 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
779510 |
agattaatgcgtgtgctctctacaaatttcgtaaggagacatgataaaattgataacgtgaaacttacctttcaacctgtgcattttatcacactccgac |
779411 |
T |
|
| Q |
122 |
ttacatcccattcaacatcagtgtgaaacgtcgcaacatggtagcaaatagtgtagcatttttctgaatccaaccttgaacacctatataaggcacgcca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779410 |
ttacatcccattcaacatcagtgtgaaacgtcgcaacatggtagcaaatagtgtagcatttttctgaatccaaccttgaacacctatataaggcacgcca |
779311 |
T |
|
| Q |
222 |
acaacaacaatgcaaaaaattttgttagac |
251 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
779310 |
acaacaacaatgcaaacaattttgttagac |
779281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University