View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_high_24 (Length: 385)
Name: NF6019_high_24
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 167 - 373
Target Start/End: Complemental strand, 21298589 - 21298383
Alignment:
| Q |
167 |
tctcaaatttatgtcggtattctgttctacatccagacctttcgtgctatggaatgcgctcgtttgctgtcccccggttctgaaatcctgactttgctca |
266 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21298589 |
tctcaaatttattttggtattctgttctacatccagacctttcgtgctatggaatgcgctggtttgctgtcccccggttctgaaatcctgactttgctca |
21298490 |
T |
|
| Q |
267 |
atgattttcagacccaatactccctgaaggatgtttacgtcgctggtcctcttgttcaatgcttcatgaacatttcttgttttttgcctggaaatgtttc |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21298489 |
atgattttcagacccaatactccctgaaggatgtttacgtccctggtcctcttgttcaatgcttcaagaacatttcttgttttttgcctggaaatgtttc |
21298390 |
T |
|
| Q |
367 |
cccttca |
373 |
Q |
| |
|
||||||| |
|
|
| T |
21298389 |
cccttca |
21298383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 21298680 - 21298585
Alignment:
| Q |
18 |
acttcccgttccgcacaatcacttatcctcggatatctaccttcctaccttgctttgctactcctatgtgctaccttaaacatatggactatctca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21298680 |
acttcccgttccgcacaatcacttatcctcggatatctaccttcctaccttgctttgctactcccatgtgctaccttaaacatatggactatctca |
21298585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University