View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_high_41 (Length: 272)
Name: NF6019_high_41
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 28429555 - 28429797
Alignment:
| Q |
1 |
catgatgaatatgctatattgtgaatgtgtgaatgatgcgggagctaaatttcatctttctcttgtctttgcttggactgaagggagctcccttttgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28429555 |
catgatgaatatgctatattgtgaatgtgtgaatgatgcgggagctaaatttcatctttctcttgtctttgcttggactgaagggagctcccttttgctg |
28429654 |
T |
|
| Q |
101 |
tttatatatcactttctttttaattttattactcattttccccttagacacttgtgataatttgaaaacatagatataattaaatgtaattatgtgtatg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
28429655 |
tttatatatcactttcttcttaattttattactcattttccccttagacacttgtgataatttgaaaaaatagatataatta--------tatgtgtatg |
28429746 |
T |
|
| Q |
201 |
tatcaagatactttagatagtagctccattttgttttcatgtcctgatgta |
251 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28429747 |
tatcaagatgctttagatagtagctccattttgttttcatgtcctgatgta |
28429797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 32289877 - 32289964
Alignment:
| Q |
17 |
tattgtgaatgtgtgaatgatgcgggagctaaatttcatctttctcttgtctttgcttggactgaagggagctcccttttgctgtttata |
106 |
Q |
| |
|
||||||||||||||||||||||| |||| | |||||| || || |||| |||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
32289877 |
tattgtgaatgtgtgaatgatgcaggaggtgaatttcttccttttctt--ctttgcttggactgaagggagctccctttttctatttata |
32289964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University