View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_high_58 (Length: 246)
Name: NF6019_high_58
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_high_58 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 11862667 - 11862897
Alignment:
| Q |
18 |
tatactcctacctataatgaccaatatgagatttgtttattgaggacaagtagaagaaaatataaatgacagttggatgcttataatatccagaaggaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11862667 |
tatactcctacctataatgaccaatatgagatttgtttattgaggacaagtagaagaaaatataaatgacagttggatgcttataatatccagaaggaaa |
11862766 |
T |
|
| Q |
118 |
tcactttatgtaagcaaagattgaggaaagca--tctctagttcaaaattcgtccctggcacgtaacctttctcatnnnnnnnntgcttgacattttgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11862767 |
tcactttatgtaagcaaagattgaggaaagcatttctgtagttcaaaattcgtccctggcacgtaacctttctcataaaaaaaatgcttgacattttgtt |
11862866 |
T |
|
| Q |
216 |
ttgccgtttgtcttgcatgcaattaattttt |
246 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
11862867 |
ttgccgtttttcttgcatgcaattaattttt |
11862897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University