View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_high_61 (Length: 242)
Name: NF6019_high_61
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 75 - 230
Target Start/End: Original strand, 32348960 - 32349115
Alignment:
| Q |
75 |
aagaggaagaagcgaaagcataccattggaggctgattctgaagctaatgagggaatgaaatcggtagactgggttaaaccctaattcagagtaagttat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32348960 |
aagaggaagaagcgaaagcataccattggaggctgattctgaagctaatgagggaatgaaatcggtagactgggttaaaccctaattcagagtaagttat |
32349059 |
T |
 |
| Q |
175 |
aatattcgatacctttgattgatttaaaaaagaaaggaagattaagttataattga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32349060 |
aatattcgatacctttgattgatttaaaaaagaaaggaagattaagttataattga |
32349115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University