View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_high_64 (Length: 239)
Name: NF6019_high_64
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_high_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 28429534 - 28429383
Alignment:
| Q |
1 |
atgaatgagtcagcagctaattcaaaaccttttcctatccctgagtggactgaagagagctctcttgaactatttttcttaataaggaagttcaagagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28429534 |
atgaatgagtcagcagctaattcaaaaccttttcctatccatgagtggactgaagagagctctcttgaactatttttcttaataaggaagttcaagagca |
28429435 |
T |
|
| Q |
101 |
aaaatcaatcattgataaccaaagattagaacaatttataactcccttgatt |
152 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28429434 |
aaaatcgatcattgataaccaaagattagaacaatttataactcccttgatt |
28429383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 28429385 - 28429346
Alignment:
| Q |
175 |
attcaactatgaagggctcatagatgaccaaagatgctca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28429385 |
attcaactatgaagggctcatagatgaccaaagatgctca |
28429346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University