View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_high_68 (Length: 228)
Name: NF6019_high_68
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_high_68 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 2918702 - 2918925
Alignment:
| Q |
1 |
ttttcctcttatttttatttcaagtttaattaaaatttcaacccttaaccgtcgtttttccattttcttttcaaattccaaaactctctcctatttagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2918702 |
ttttcctcttatttttatttcaagtttaa----aatttcaacccttaaccatcgtttttccattttcttttcaaattccaaaactctcttctatttagat |
2918797 |
T |
|
| Q |
101 |
tttaaggatgtaaggtgttccacgttatttctacgtgttttattcaacatgtgaggatcctaatcatgttttgcataaggtttaagtctttatgaatcat |
200 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
2918798 |
tttaaggatgtcaggtgttccacattatttctacgtgttttattcaacatgtgaggatcctaatcatgttttgcataaggtttgagtctttctgaatcat |
2918897 |
T |
|
| Q |
201 |
ctttatacactacagtttccagtgtaat |
228 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
2918898 |
ctttatacagtacagtttccagtgtaat |
2918925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University