View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6019_high_77 (Length: 206)

Name: NF6019_high_77
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6019_high_77
NF6019_high_77
[»] chr3 (1 HSPs)
chr3 (18-113)||(21298585-21298680)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 21298680 - 21298585
Alignment:
18 acttcccgttccgcacaatcacttatcctcggatatctaccttcctaccttgctttgctactcctatgtgctaccttaaacatatggactatctca 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
21298680 acttcccgttccgcacaatcacttatcctcggatatctaccttcctaccttgctttgctactcccatgtgctaccttaaacatatggactatctca 21298585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University