View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_30 (Length: 334)
Name: NF6019_low_30
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 324
Target Start/End: Complemental strand, 31928461 - 31928156
Alignment:
| Q |
19 |
gaatatctgtgttgcaaattgtggtatatggtaagctataacccgaccaagaccaaaataatctttaacatgagaacaaaaatatgctcttgtgatagat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31928461 |
gaatatctgtgttgcaaattgtggtatatggtaagctgtaacccgaccaagaccaaaataatctttaacatgagaacaaagatatgctcttgtgatagat |
31928362 |
T |
 |
| Q |
119 |
ttcatacaagtggaccaattgcctctctattttgatgtggacacttgttgtattagtcaagattgtcttcagctactttatttctcaacattcacgtgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31928361 |
ttcatacaagtggaccaattgcctctctattttgatgtggacacttgttgtattagtcaagattgtcttcagctactttatttctcaacattcacgtgat |
31928262 |
T |
 |
| Q |
219 |
attgtccttaaattagcaatggcatggcattttgatcttgaaaatttgatgcaagcttatgatcataaacaagagtcaacattaaaccttaattacaatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31928261 |
attgtccttaaattagcaatggcatggcattttgatcttgaaaatttgatgcaagcttatgatcataaacaagagtcaacattaaaccttaattacaatg |
31928162 |
T |
 |
| Q |
319 |
atgatg |
324 |
Q |
| |
|
|||||| |
|
|
| T |
31928161 |
atgatg |
31928156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University