View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_37 (Length: 288)
Name: NF6019_low_37
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 42037638 - 42037456
Alignment:
| Q |
19 |
tctctttgcaatgatgttggtttatgatgcagattccttgnnnnnnnagttatgtcccgnnnnnnnnatctctggtttcacacaggcacacatacaaaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42037638 |
tctctttgcaatgatgttggtttatgatgcagattccttgtttttttagtcatgtcccgttttttttatctctggtttcacacaggcacacatacaaaca |
42037539 |
T |
|
| Q |
119 |
ctaaaattaaatagagtgctaatagttattggtgaaccaagcattttctttctctgtgcaattgaggttagggttcttaatta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037538 |
ctaaaattaaatagagtgctaatagttattggtgaaccaagtattttctttctctgtgcaattgaggttagggttcttaatta |
42037456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University