View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_38 (Length: 288)
Name: NF6019_low_38
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 607585 - 607849
Alignment:
| Q |
19 |
aaaatgcgcaaccagcaccacca-----ggtctgaatacaacccgaagcagcaagatgtttgttgttgtcttcctcagtatgcgaggttcatgtgctctg |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
607585 |
aaaatgcgcaaccagcaccaccagaccaggtctgagtacaacctgaagcagcaagatgtttgttgttgtgttcctcagtatgcgaggttcatgtgctctg |
607684 |
T |
|
| Q |
114 |
tgttttatgtgacgtatcttgtgtacacgttgtgtcttgtgcatcattgcactatcctctgtaacgcctctttttacgatgtcc-----atgtgacgcga |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
607685 |
tgtcttatgtgacgtatcttgtgtacacgttgtgtcttgtgcatcattgcactatcctctgtaacgcctctttttacgatgtccatattatgtgacgcga |
607784 |
T |
|
| Q |
209 |
aacctatcgagatatgtatatacaagattgcttgttttatcttttgtgacattggctcgtctgtg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
607785 |
aacctatcgagatatgtatatacaagattgcttgttctatcttttgtgacattgtctcgtgtgtg |
607849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University