View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_44 (Length: 268)
Name: NF6019_low_44
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 28081750 - 28081995
Alignment:
| Q |
1 |
ctagtactttctgttagcttattttagattttagaannnnnnnnnnattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtct |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081750 |
ctagtactttttgttagcttattttagaatttagaattttttttttattggctatgtaatatggagttgtagaattagggaacatcttttcttcatgtct |
28081849 |
T |
|
| Q |
101 |
gctggagaaagaaatgtagtagctaaagtgaactatttttgttttatcattat--tctgtgttgagtgagtgnnnnnnnnnnnnnnngtttctcaattac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
28081850 |
gctggagaaagaaatgtagtagctaaagtgaactatttttgttttatcattattatctgtgttgagtgagtg------tatatatatgtttctcaattac |
28081943 |
T |
|
| Q |
199 |
cataaatgtgaattcaacttgataagttttatggattattgatatgattatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081944 |
cataaatgtgaattcaacttgataagttttatggattattgatatgattatc |
28081995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University