View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_52 (Length: 256)
Name: NF6019_low_52
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 118 - 246
Target Start/End: Complemental strand, 42037270 - 42037142
Alignment:
| Q |
118 |
ccgtaagaatataatggcttagtaacacactttctaacaggttttttaatacattcttttttattggttgaaattttgcatgagagcgagtatgttactc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42037270 |
ccgtaagaatataatggcttagtaacacactttctaacacgttttttaatacattcttttttattggttgaaattttgcatgagagcgagtatgtcactc |
42037171 |
T |
|
| Q |
218 |
tatttatctctcttcttcttatattttct |
246 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
42037170 |
tatttatctctcttcttcttatatattct |
42037142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 42037387 - 42037344
Alignment:
| Q |
1 |
tgtttccctctttgtttattcacttttacaatgattaaacacta |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42037387 |
tgtttccctctttgtttattcacttttacaatgattaaacacta |
42037344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University