View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_75 (Length: 222)
Name: NF6019_low_75
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 14 - 175
Target Start/End: Complemental strand, 1457413 - 1457252
Alignment:
| Q |
14 |
cataggttcaagattttgcataacagacttttgcaatggagatttattaatgctagagctgatacttccatggctagggtaaaaaatgcagctgaggtan |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1457413 |
cataagttcaagattttgcataacagacttttgcaatggagatttattaatgctagagctgatacttccatggctagggtaaaaaatgcagctgaggtat |
1457314 |
T |
|
| Q |
114 |
nnnnnnnnctaatgaaaaatattagtaattttttgttagaaatgttagtaggaaaattgaag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1457313 |
ttttttttctaatgaaaaatattagtaattttttgtttgaaatgttagtaggaaaattgaag |
1457252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University