View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6019_low_76 (Length: 220)

Name: NF6019_low_76
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6019_low_76
NF6019_low_76
[»] chr4 (1 HSPs)
chr4 (18-202)||(22273476-22273661)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 22273661 - 22273476
Alignment:
18 gaggatccagtcacataaggatacctaaaaatcaaaccaacatttaggtcaatttcaaaacaaa-tcgatgaacaaacaaaataaactatctcaattttc 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
22273661 gaggatccagtcacataaggatacctaaaaatcaaaccaacatttaggtcaatttcaaaacaaaatcgatgaacaaacaaaataaactatctcaattttc 22273562  T
117 gcgttgcacaaaaccttaaactgagtaaattgaaaaacacacacgccaacgaatgaattcactagagagagaaagaagggacatac 202  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22273561 gcgttgcacaaaaccttaaactgagtaaattgaaaaacacacacaccaacgaatgaattcactagagagagaaagaagggacatac 22273476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University