View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6019_low_81 (Length: 201)
Name: NF6019_low_81
Description: NF6019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6019_low_81 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 87 - 184
Target Start/End: Complemental strand, 28418932 - 28418835
Alignment:
| Q |
87 |
catttgtacgagggatctaagatttgtaagagatcaacaacatctcatgtgatgagatgtctataaattgtacgaggtatctaagatgttgtacttat |
184 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28418932 |
catttgtacgagggatctaacatttgtaagagatcaacaacatctcatgtgatgtgatgtctataaattgtacgaggtatctaagttgttgtacttat |
28418835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 88
Target Start/End: Original strand, 5659794 - 5659847
Alignment:
| Q |
35 |
gttattattttaaattgcggtgttgcggttgctgttttcgcttcaggtgcaaca |
88 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
5659794 |
gttattatttgaagttgcggtgttgcggttgctgtttacgcatcaggtacaaca |
5659847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 88
Target Start/End: Complemental strand, 16088038 - 16087984
Alignment:
| Q |
34 |
ggttattattttaaattgcggtgttgcggttgctgttttcgcttcaggtgcaaca |
88 |
Q |
| |
|
||||||||||| || |||||||||||||||| |||||| ||| |||||| ||||| |
|
|
| T |
16088038 |
ggttattatttgaagttgcggtgttgcggttactgtttacgcatcaggtacaaca |
16087984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University