View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_high_16 (Length: 444)
Name: NF6020_high_16
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 19 - 433
Target Start/End: Original strand, 5998659 - 5999073
Alignment:
| Q |
19 |
aaactcgcgtgctgtgaagcatcatgagttattgactaacaaccacgagaagcttttgaaggaagattgggagcttcaaagaaggacgatatttacagat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998659 |
aaactcgcgtgctgtgaagcatcatgagttattgactaacaaccacgagaagctttcgaaggaagattgggagcttcaaagaaggacgatatttacagat |
5998758 |
T |
 |
| Q |
119 |
ttggaggtggcaactacgtttatgagcatcgcattttatctcgctttcagcatgcgtaaagaagcaccttctttccttatggtgacccttgtgctcgcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998759 |
ttggaggtggcaactacgtttatgagcatcgcattttatctcgctttcagcatgcgtaaagaagcaccttctttccttatggtgacccttgtgctcgcat |
5998858 |
T |
 |
| Q |
219 |
gcatcacatcgttcacgtctgttttgatttttggtgtgatcattgcattgggtgtcacgaaaggtaccttgaggaagttgccgatgagatgcggccatgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998859 |
gcatcacatcgttcacgtctgttttgatttttggtgtgatcattgcattgggtgtcacgaaaggtaccttgaggaagttgccgatgagatgcggccatgt |
5998958 |
T |
 |
| Q |
319 |
tacgagctatctattgacattggcattgctggtctttgcattcattgttatgtcgttccagaattcaaagggcaccgtgggatgacataccattgttatt |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998959 |
tacgagctatctattgacattggcattgctggtctttgcgttcattgttatgtcgttccagaattcaaagggcaccgtgggatgacataccattgttatt |
5999058 |
T |
 |
| Q |
419 |
catgtggtgatgatg |
433 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5999059 |
catgtggtgatgatg |
5999073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University