View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_high_31 (Length: 293)
Name: NF6020_high_31
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 17 - 291
Target Start/End: Complemental strand, 8058982 - 8058708
Alignment:
| Q |
17 |
aacaactgcaagattccttttcatttcatcatttgaatttgaatgttgaacaacaatttcttcttccggtgaagatttcttacaactattctttttgacg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8058982 |
aacaactgcaagattccttttcatttcatcatttgaatttgaatgttgaacaacaatttcttcttccggtgaagatttcttacaactattctttttgatg |
8058883 |
T |
 |
| Q |
117 |
tagccgttgtttcgtcgaattctaacgtactttctcttagttcttttacctggaagtgaagcagtggtgctctggttcgccggagtttgttctccggtga |
216 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058882 |
taaccgttgtttcttcgaattctaacgtactttctcttagttcttttacctggaagtgaagcagtggtgctctggttcgccggagtttgttctccggtga |
8058783 |
T |
 |
| Q |
217 |
ctggcttcggtgcgattggtcggaaacggagcattattccgttgaagatattgttgtcgttgttgagagaagggt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058782 |
ctggcttcggtgcgattggtcggaaacggagcattattccgttgaagatattgttgtcgttgttgagagaagggt |
8058708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University