View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_high_36 (Length: 277)
Name: NF6020_high_36
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 25614899 - 25615002
Alignment:
| Q |
19 |
tttaatgtgcatataagagtttaatatgctatgagatattttacagaaaatttattagatacaatacaacattactaaatattcaccattgttgtgatta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614899 |
tttaatgtgcatataagagtttaatatgctacgagatattttacagaaaatttatcagatacaatacaacattactaaatattcaccattgttgtgatta |
25614998 |
T |
 |
| Q |
119 |
tcta |
122 |
Q |
| |
|
|||| |
|
|
| T |
25614999 |
tcta |
25615002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University