View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_high_51 (Length: 232)
Name: NF6020_high_51
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_high_51 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 116 - 232
Target Start/End: Original strand, 49910401 - 49910517
Alignment:
| Q |
116 |
ataatggttcttgtttaagagaaatcaatactaggttttactcgtaaatgattctcctctttgcccggattcctagtaatgcgtagaattgatttcagag |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910401 |
ataatggttcttgtttaagagaaatcgatactaggttttactcgtaaatgattctcctctttgcccggattcctagtaatgcgtagaattgatttcagag |
49910500 |
T |
 |
| Q |
216 |
caattggttcaagatga |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49910501 |
caattggttcaagatga |
49910517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 49910286 - 49910364
Alignment:
| Q |
1 |
cttatttgtcttgcgttgctcttcctctctagtcgtctcgcatttgcaaccattgtgtctctccatctaatacaatgca |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910286 |
cttatttgtcttgcgttgctcttcctctctagtcgtctcgcgtttgcaaccattgtgtctctccatctaatacaatgca |
49910364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University