View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_17 (Length: 441)
Name: NF6020_low_17
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_17 |
 |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |
|
| [»] chr8 (9 HSPs) |
 |  |
|
| [»] chr7 (10 HSPs) |
 |  |
|
| [»] chr5 (7 HSPs) |
 |  |
|
| [»] chr4 (10 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] chr2 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 111 - 382
Target Start/End: Original strand, 15642221 - 15642499
Alignment:
| Q |
111 |
gagtacagttttcaaagtatagataatatcaattctttcccaaagtcatccaattatatat------acaaatgagtagttgagaaatatttctaattta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||| || |
|
|
| T |
15642221 |
gagtacagttttcaaagtatagataatatcaattctttcccaaagtcatccaattatatattatcatacaaatgagtagttgtgaaacatttctaatata |
15642320 |
T |
 |
| Q |
205 |
gaagag--ttcaaatttgaaaggattaaactagatgagaaatatccctgatttggattcattcacactaatattttgtttttgtagcatactcatgattg |
302 |
Q |
| |
|
|||||| |||||||| |||| |||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15642321 |
gaagagagttcaaattagaaaagattaaaccaaatgagaaata-ccctgatttggattcattcacactaatattttgtttttgtagcatactcatgattg |
15642419 |
T |
 |
| Q |
303 |
gatcaattgagttcacatttgctttagatccctnnnnnnngaaacgtcttgacccactaatacccagctaatattgcaca |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15642420 |
gatcaattgagttcacatttgctttagatccctaaaaatagaaacgtcttgacccactaatacccagctaatattgcaca |
15642499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 15642111 - 15642165
Alignment:
| Q |
1 |
atgaattcaaaatatttgtaactcgaattgatcgattttatcacaaaacacagtg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15642111 |
atgaattcaaaatatttgtaactcgaattgatcgattttatcacaaaacacagtg |
15642165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 15642534 - 15642590
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
15642534 |
agggagagtttgccgcccatttgggtcccacaatgctcgagagattattctccgcag |
15642590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 44913188 - 44913244
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
44913188 |
agggagagcttgccgcccatctgggtcccacaatgctcgagagattagtctctgcag |
44913244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 436
Target Start/End: Original strand, 12035629 - 12035680
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctc |
436 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
12035629 |
agggagagtctgccgcccatttgggtcccacaatgctcgagggattagtctc |
12035680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 431
Target Start/End: Original strand, 33721019 - 33721065
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagatta |
431 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| | ||||||||||| |
|
|
| T |
33721019 |
agggagagtttgccgtccatttggatcccacaaggttcgagagatta |
33721065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 395 - 441
Target Start/End: Original strand, 36806700 - 36806746
Alignment:
| Q |
395 |
tgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||| | |||||||||||||| ||||| ||||||||| |
|
|
| T |
36806700 |
tgccgcccatttgggttccacaatgctcgagggattagtctctgcag |
36806746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 2044476 - 2044532
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| || ||||| |||||| | ||||||||||| |||||||| ||||||||| |
|
|
| T |
2044476 |
agggagagattaccgcctatttgggttccacaatgctcaagagattagtctctgcag |
2044532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 26410 - 26466
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||||||| |||| |||| |
|
|
| T |
26410 |
agggagagcctgccgcccatttgggtcccacaatgttcgagagattagtctccgcag |
26466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 4125086 - 4125030
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
4125086 |
agggagagcctgccgcccatttgggtcccacaatgctcgagggattagtctccgcag |
4125030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 7839315 - 7839259
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
7839315 |
agggagagcatgccgcccatttgggtcccacaatgctcgagggattagtctccgcag |
7839259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 425
Target Start/End: Complemental strand, 19715788 - 19715748
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgag |
425 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19715788 |
agggagagcttgccgcccatttgggtcccacaatgctcgag |
19715748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 439
Target Start/End: Original strand, 15683008 - 15683062
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgc |
439 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||| ||||| ||||||| |
|
|
| T |
15683008 |
agggagagcctgccgcccatttaggtcccacaatgctcgagggattaatctctgc |
15683062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 12958147 - 12958091
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
12958147 |
agggagagcctgtcgcccatttgggtcccacaatgctcgagggattagtctccgcag |
12958091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 438
Target Start/End: Original strand, 40320178 - 40320228
Alignment:
| Q |
388 |
gagagcttgccgcccatttggatcccacaatgctcgagagattattctctg |
438 |
Q |
| |
|
||||| |||||| | ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
40320178 |
gagagtttgccgtctatttggatcccacgatgctcgagagattagtctctg |
40320228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 2744012 - 2744068
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| || || |||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
2744012 |
agggagagcatgtcgtccatttgggtcccacaatgctcgagggattagtctccgcag |
2744068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 30056063 - 30056011
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctct |
437 |
Q |
| |
|
||||||||| ||||| |||||||| | |||||||||||||| ||||| ||||| |
|
|
| T |
30056063 |
agggagagcctgccgtccatttgggttccacaatgctcgagggattagtctct |
30056011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 30936083 - 30936139
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| ||| |||||| ||||| ||||| |||| |||| |
|
|
| T |
30936083 |
agggagagcctgccgcccatttgggtccgacaatgttcgagggattagtctccgcag |
30936139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 29428854 - 29428798
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
29428854 |
agggagagtttgccgaccatttggatcccacaatgttcgagggattagtctctgcag |
29428798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 441
Target Start/End: Original strand, 20207578 - 20207632
Alignment:
| Q |
387 |
ggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| ||||| |||| |||| |
|
|
| T |
20207578 |
ggagagcttgccgcgcatttggatcctacaatgctcgagggattagtctccgcag |
20207632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 431
Target Start/End: Original strand, 46373752 - 46373798
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagatta |
431 |
Q |
| |
|
||||||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
46373752 |
agggagagcttgccgcctatttgggtcacacaatgctcgagagatta |
46373798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 441
Target Start/End: Original strand, 24172291 - 24172344
Alignment:
| Q |
388 |
gagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
24172291 |
gagagcttgccgcccacttggatcccacaatgctcgaaggattagtctatgcag |
24172344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 11486802 - 11486754
Alignment:
| Q |
389 |
agagcttgccgcccatttggatcccacaatgctcgagagattattctct |
437 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| |||||||| ||||| |
|
|
| T |
11486802 |
agagcttgccgcccatttgggttccacaatgctcaagagattagtctct |
11486754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 29059884 - 29059940
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| ||| ||||| |||| |||| |
|
|
| T |
29059884 |
agggagagcctgccgcccatttgggtcccacaatgcttgagggattagtctccgcag |
29059940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 31492182 - 31492238
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||| ||||| |||| |||| |
|
|
| T |
31492182 |
agggagagcctgccgcccatttaggtcccacaatgctcgagggattagtctccgcag |
31492238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 35707925 - 35707981
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||| |||||| ||||||| ||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
35707925 |
agggagaacttgcctcccatttagatcctacaatgctcgagggattagtctctgcag |
35707981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 431
Target Start/End: Complemental strand, 13254163 - 13254117
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagatta |
431 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
13254163 |
agggagagcctgccgcccatttaggtcccacaatgctcgagggatta |
13254117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 421
Target Start/End: Complemental strand, 19477311 - 19477275
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgct |
421 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19477311 |
agggagagcttgccggccatttgggtcccacaatgct |
19477275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 5123560 - 5123504
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
5123560 |
agggagagcctgccgcccatttgggtcccacaatgctcgagggattagtctccgcag |
5123504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 2798377 - 2798321
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||||| |||||||||||| | | ||||||||| |||||||| ||||||||| |
|
|
| T |
2798377 |
agggagagcttaccgcccatttggtttctacaatgctctagagattaatctctgcag |
2798321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 2804544 - 2804488
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||||| |||||||||||| | | ||||||||| |||||||| ||||||||| |
|
|
| T |
2804544 |
agggagagcttaccgcccatttggtttctacaatgctctagagattaatctctgcag |
2804488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 10592006 - 10592062
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
10592006 |
agggagagtctgccgcccatttgagtcccacaatgctcgagggattagtctctgcag |
10592062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 31113413 - 31113469
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| |||||| ||||| |||| |||| |
|
|
| T |
31113413 |
agggagagcctaccgcccatttggatcccacaatactcgagggattagtctccgcag |
31113469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 430
Target Start/End: Original strand, 36212975 - 36213020
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagatt |
430 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
36212975 |
agggagagtttgccgcccatttaggtcccacaatgctcgagggatt |
36213020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 25983744 - 25983800
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||| ||||| |||| |||| |
|
|
| T |
25983744 |
agggagagcttgccgcccatttgagtcccataatgttcgagtgattagtctccgcag |
25983800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 9012349 - 9012405
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
9012349 |
agggagagcttgccgcccacttgggtcccacaatgctcgagggattagtctccgcag |
9012405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 14854684 - 14854740
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| |||||| ||||| ||||||||| |
|
|
| T |
14854684 |
agggagagcttgccgcccatttgggtccaacaattctcgagggattagtctctgcag |
14854740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 31307128 - 31307072
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
31307128 |
agggagagcctgccgcccatttgggtcccacaatgctcgagggattagtctccgcag |
31307072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 33529336 - 33529392
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||| ||||| |||| |||| |
|
|
| T |
33529336 |
agggagagcttgccgcccatttgggtcccacaatactggagggattagtctccgcag |
33529392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 45994601 - 45994657
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| || ||||||||||| || ||||||||||||||||||| |||| |||| |
|
|
| T |
45994601 |
agggagagcctgacgcccatttgggtctcacaatgctcgagagattagtctccgcag |
45994657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 424
Target Start/End: Original strand, 46016228 - 46016267
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcga |
424 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46016228 |
agggagagcctgccgcccatttgggtcccacaatgctcga |
46016267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 436
Target Start/End: Original strand, 13686680 - 13686732
Alignment:
| Q |
384 |
aagggagagcttgccgcccatttggatcccacaatgctcgagagattattctc |
436 |
Q |
| |
|
||||||||| |||||| |||||||| || ||||| ||||||||||||| |||| |
|
|
| T |
13686680 |
aagggagagtttgccgtccatttgggtctcacaaggctcgagagattagtctc |
13686732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 35972422 - 35972478
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| ||| ||||| ||||| |||| |||| |
|
|
| T |
35972422 |
agggagagtttgccgcccatttgggtcccactatgttcgagggattagtctccgcag |
35972478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 38766168 - 38766224
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| |||||||||||||| || ||||||||||||| ||||| |||| |||| |
|
|
| T |
38766168 |
agggagagtctgccgcccatttgggtctcacaatgctcgagggattagtctccgcag |
38766224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 51626368 - 51626312
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||| |||||||||||||| |||| |||| |
|
|
| T |
51626368 |
agggagagtctgccgtccatttgggtcccacagtgctcgagagattagtctccgcag |
51626312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 431
Target Start/End: Complemental strand, 27287 - 27241
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagatta |
431 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| ||||| |
|
|
| T |
27287 |
agggagagcttgccgcccatttggatctcacgatgctcgagggatta |
27241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 394 - 431
Target Start/End: Original strand, 15283159 - 15283196
Alignment:
| Q |
394 |
ttgccgcccatttggatcccacaatgctcgagagatta |
431 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15283159 |
ttgccgcccatttgggtcccacaatgctcgagagatta |
15283196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 21223516 - 21223461
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgca |
440 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||| ||| |||| |||||||| |
|
|
| T |
21223516 |
agggagagcttgtcgcctatttagatcccacaatgctcaagaaattagtctctgca |
21223461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 441
Target Start/End: Original strand, 38331210 - 38331263
Alignment:
| Q |
388 |
gagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | ||| ||||| |||| |||| |
|
|
| T |
38331210 |
gagagcttgccgcccatttgggtcccacaatgtttgagggattagtctccgcag |
38331263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 20861327 - 20861383
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| | ||| |||||||||| ||||| |||| |||| |
|
|
| T |
20861327 |
agggagagcctgccgcccatttgggttccataatgctcgagggattagtctccgcag |
20861383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 441
Target Start/End: Complemental strand, 30996027 - 30995971
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
30996027 |
agggagagtctgccgcccatctgggtcccacaatgctcgagggattagtctccgcag |
30995971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 441
Target Start/End: Original strand, 34386565 - 34386618
Alignment:
| Q |
388 |
gagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||| | ||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
34386565 |
gagagcttgccgtctatttggatctcataatgctcgagagattaatctctgcag |
34386618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 5394475 - 5394531
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| | ||||| |||| |||| |
|
|
| T |
5394475 |
agggagagcctgccgcccatttgggtcccacaatgctcgtgggattagtctccgcag |
5394531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 17981577 - 17981632
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||| |||| |||| |
|
|
| T |
17981577 |
agggagagcttgccgca-atttgggtcccacaatgctcgagagattagtctccgcag |
17981632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 441
Target Start/End: Original strand, 25423823 - 25423879
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctctgcag |
441 |
Q |
| |
|
||||||| | |||||||||||||| |||||||||||||||| ||||| |||| |||| |
|
|
| T |
25423823 |
agggagaacctgccgcccatttgggtcccacaatgctcgagggattagtctcagcag |
25423879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 436
Target Start/End: Complemental strand, 7020422 - 7020371
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctc |
436 |
Q |
| |
|
||||||| |||||||||||||||| ||| |||||||||||| ||||| |||| |
|
|
| T |
7020422 |
agggagaacttgccgcccatttgggtcctacaatgctcgagtgattagtctc |
7020371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 387 - 436
Target Start/End: Original strand, 26296440 - 26296489
Alignment:
| Q |
387 |
ggagagcttgccgcccatttggatcccacaatgctcgagagattattctc |
436 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||| ||||||||||||| |||| |
|
|
| T |
26296440 |
ggagagtttgccgcccaattgaatcccacaaggctcgagagattagtctc |
26296489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 436
Target Start/End: Complemental strand, 12836959 - 12836908
Alignment:
| Q |
385 |
agggagagcttgccgcccatttggatcccacaatgctcgagagattattctc |
436 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| ||| ||||| |||| |
|
|
| T |
12836959 |
agggagagctcgccgcccatttgggtcccacaatgcttgagggattagtctc |
12836908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University