View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_22 (Length: 410)
Name: NF6020_low_22
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 9e-83; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 199 - 402
Target Start/End: Complemental strand, 42797791 - 42797601
Alignment:
| Q |
199 |
taattattttggaagttacgttgttttaatatgtatagggaaatggattgaatattttggtgaaggttagataaaactgcttctaaatgacacatcttat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42797791 |
taattattttggaagttacgttgttttaatatgtatagggaaatggattgaatattttggtgaaggttagataaaactgcttctaaatgacacatcttat |
42797692 |
T |
|
| Q |
299 |
cttccaaagaagtttttgatagttcaatatccttgttcaattttaccaattcgttggaatacattttctttctctatttgcaggctcaccctttgtttct |
398 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42797691 |
cttccaaagaagtttttgatagtt-------------caattctaccaattcgttggaatacattttctttctctatttgcaggctcaccctttgtttct |
42797605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 42798208 - 42798152
Alignment:
| Q |
149 |
gcacaactcatattatcaaacggtttcttgatttagcatatagttgataataattat |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42798208 |
gcacaactcatattatcaaatggtttcttgatttagcatatagttgataataattat |
42798152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 42798308 - 42798249
Alignment:
| Q |
18 |
cagaatcgacaaaagagagcattcatacaaatcaaatagaaattggatcagttttaagatat |
79 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42798308 |
cagaatcgacaaaagag--cattcatacaaattaaatagaaattggatcagttttaagatat |
42798249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University