View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_26 (Length: 351)
Name: NF6020_low_26
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 191 - 332
Target Start/End: Complemental strand, 38028477 - 38028347
Alignment:
| Q |
191 |
atttaagataatagttctctacaacttgaaaacaatatttattaaaatgaaaaagatgtattatattttttgtacttatcagttatcaaacggaaagcat |
290 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38028477 |
atttgagataatagttctctacaccttgaaaacaatatttattaaaatgaaaaagatgtattatcg-----------atcagttatcaaacggaaagcat |
38028389 |
T |
|
| Q |
291 |
ataggatccccatgttgttgaattctacatggtcctgacttg |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38028388 |
ataggatccccatgttgttgaattctacatggtcctgacttg |
38028347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University