View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_31 (Length: 326)
Name: NF6020_low_31
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 176 - 319
Target Start/End: Complemental strand, 3241019 - 3240876
Alignment:
| Q |
176 |
ccatttgcatcaacatcatattgactatgatgccattcaagttgagtaaggtggtatgctgaattagaaacttcagatcttctacattttgtttttgcac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3241019 |
ccatttgcatcaacatcatattgactatgatgccattcaagttgagtaagatggtatgctgaattagaaacttcagatcttctacattttgtttttgcac |
3240920 |
T |
 |
| Q |
276 |
cattttcaaagtccatatgaacatattcactaacagaataatct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3240919 |
cattttcaaagtccatatgaacatattcactaacagaataatct |
3240876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 15 - 93
Target Start/End: Complemental strand, 3241176 - 3241098
Alignment:
| Q |
15 |
tcatcatctgaatcagaatccagaatactgactgaatcaaagtaactctcatcttggcacattactacaaacaagcaac |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3241176 |
tcatcatctgaatcagaatccagaatactgactgaatcaaagtaactctcatcttggcacattactacaaacaagcaac |
3241098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University