View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_37 (Length: 283)
Name: NF6020_low_37
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 25615433 - 25615311
Alignment:
| Q |
1 |
ttcaaggacatcgaacatagaaagaatttatgtaatacattgagaacaaaaatttcaattcagttgacnnnnnnngattctatatcgaagctaaaacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25615433 |
ttcaaggacatcgaacatagaaagaatttatgtaatacattgagaacaaaaatttcaattcagttgacaaaaaaagattctatatcgaagctaaaacata |
25615334 |
T |
|
| Q |
101 |
ttaagcaatgtatctcattgaaa |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25615333 |
ttaagcaatgtatctcattgaaa |
25615311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 266
Target Start/End: Complemental strand, 24992972 - 24992809
Alignment:
| Q |
123 |
atcagaggtgacctcttcaactgtcttttctcaaagtcattcaaagtttccgggctttgatctccgcttgagcttctga--------------------t |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||| | |
|
|
| T |
24992972 |
atcagaggtgacctcttcaactgtcttttctctaagtcattcaaagttttcgggctatgatctccgcttgagcttctgattaattgaatatagagcttct |
24992873 |
T |
|
| Q |
203 |
gattatctgtaactataaatagggagagaaggcaccacaatcaacgaacacaacaaaattgagt |
266 |
Q |
| |
|
||||||||||||| | ||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
24992872 |
gattatctgtaaccacaaatagggagagaagacaccacaatcaacgaacacaataaaattgagt |
24992809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University