View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_47 (Length: 249)
Name: NF6020_low_47
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_47 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 32541962 - 32541729
Alignment:
| Q |
16 |
cagcttttggttctgatatatcggtaaatggctgccacaagcaactacaagaacgcctttatgaatgacatagcgtgtttggaaaatgcaaaaaccaccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32541962 |
cagcttttggttctgatatatcggtaaatggctgccacaagcaactacaagaacgcctttatgaatgacatagcgtgtttggaaaatgcaaaaaccaccg |
32541863 |
T |
|
| Q |
116 |
tgttgctgttaaaatctcggtgaaatggcatgtattggaatgtgggaaaatgaggcaagaatccgattgaaacagatcgtaagcagttaaattccattta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32541862 |
tgttgctgttaaaatctcggtgaaatggcatgtattggaatgtgggaaaatgaggcaagaatccgattgaaacagatcgtaagcagttaaattccattta |
32541763 |
T |
|
| Q |
216 |
gtttgtttttgccaatgatgattgtctttggact |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32541762 |
gtttgtttttgccaatgatgattgtctttggact |
32541729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University