View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6020_low_51 (Length: 237)
Name: NF6020_low_51
Description: NF6020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6020_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1416110 - 1416335
Alignment:
| Q |
1 |
aatatctcattccatctcccctccacaactcccaactagataaaaccttgtggtaagcagatgattctttaagtcacattaccctttctagtgtgtccta |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1416110 |
aatatctcatttcatctcccctccacaactcccaactagatagaaccttgtggtaaacagatgattctttaagtcacattaccctttctagtgtgtccta |
1416209 |
T |
 |
| Q |
101 |
gccttaaacgtagggagttgctcataaacaatgaatttgccacaaacataacccattctaccattagagagagaaagaa--ataaagaggataaatgaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
1416210 |
gccttaaacgtagggagttgctcataaacaatgaatttgccacaaacataacccattctaccattagagagagaaagaaatataaagagaataaatgaaa |
1416309 |
T |
 |
| Q |
199 |
gaagtgataggttgatgatatgagtg |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1416310 |
gaagtgataggttgatgatatgagtg |
1416335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University