View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_107 (Length: 230)
Name: NF6021_high_107
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_107 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 4669830 - 4670024
Alignment:
| Q |
21 |
gatctgatgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggccggttcatcatccataccatcttctggtacccctat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
4669830 |
gatctgatgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggctggttcatcatccataccatcttttggtacccctat |
4669929 |
T |
 |
| Q |
121 |
aactttttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatgtgtagacccaccatgtatt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4669930 |
aactttttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatatgtagacccaccatgtatt |
4670024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 130 - 205
Target Start/End: Original strand, 10872953 - 10873036
Alignment:
| Q |
130 |
tttctcttttgaaggagctcattctttcatcacatggttg--------tagcatccccaatgcatacaaattatgtgtagaccc |
205 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| | |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
10872953 |
tttctcttttgaaggagcacactctttcatcacatggtcgtagactcatagcatccacaatacatacaaattatgtgtagaccc |
10873036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University