View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_110 (Length: 227)
Name: NF6021_high_110
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_110 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 6863560 - 6863424
Alignment:
| Q |
1 |
tatagcataatgaagaatttgctgccaatcctactgcatacgctgcattcaaaggcaaacatgctccgtccaaatattgtgatacccttttgttataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
6863560 |
tatagcataatgaagaatttgctgccaatcctactgtatacgctgcattcaaaggcaaacatgctccgtccaaatattgtgataccatttgcttataatt |
6863461 |
T |
 |
| Q |
101 |
gtcaatcctactgcatcatgtattatacaaacatgat |
137 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
6863460 |
gccaatcctactgcatcatgtattatacgaacatgat |
6863424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 6863428 - 6863392
Alignment:
| Q |
177 |
atgatttgttttgtgcctgcattgcttgtcctttgct |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6863428 |
atgatttgttttgtgccagcattgcttgtcctttgct |
6863392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University