View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_111 (Length: 226)
Name: NF6021_high_111
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_111 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 17166028 - 17165835
Alignment:
| Q |
17 |
atcaaagatgttcaggttgttcctaggtttattggtgaatggggtgatattgttattacattaaaagatggtactaaggttgatcttaggagtgttccta |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17166028 |
atcaaagatgttcaggttgttccaaggtttattggtgaatggggtgatattgttattacattaaaagatggtactaaggttgatcttaggagtgttccta |
17165929 |
T |
 |
| Q |
117 |
agtttagagaaattgccaagtattgtttgtctatgaaggagaagaattctaaggttttgaatcaatctggtcctaaaggcttttgatttatttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17165928 |
agtttagagaaattgccaagtattgtttgtctatgaaggagaagaattctaagggtttggatcaatctggtcctaaaggcttttgatttatttt |
17165835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University