View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6021_high_115 (Length: 218)

Name: NF6021_high_115
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6021_high_115
NF6021_high_115
[»] chr8 (1 HSPs)
chr8 (25-206)||(42623099-42623280)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 25 - 206
Target Start/End: Complemental strand, 42623280 - 42623099
Alignment:
25 ctcttattcttggattgtttcaattttgttattaacttttcgattattctgattaggatcctgaattgcctccgattgtggaagaagaaggtgaatccct 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
42623280 ctcttattcttggattgtttcaattttgttattaacttttcgattattctgattaggatcctgaattgcctccgattgtggaagaagaaggtgaatcctt 42623181  T
125 accagttcctaacgatgagagggctcttgtactcttcaaacccatgaatcttcattctccttccgatttctctctcactctc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42623180 accagttcctaacgatgagagggctcttgtactcttcaaacccatgaatcttcattctccttccgatttctctctcactctc 42623099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University