View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_119 (Length: 213)
Name: NF6021_high_119
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_119 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 4082560 - 4082378
Alignment:
| Q |
19 |
tttcagatctttgaatctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaacgag- |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082560 |
tttcagatctttgaatctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaacgagc |
4082461 |
T |
|
| Q |
118 |
--acaagtgttaaacacactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082460 |
acacaagtgttaaacacactgtgatatcagttgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
4082378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 23 - 198
Target Start/End: Complemental strand, 4092265 - 4092087
Alignment:
| Q |
23 |
agatctttgaatctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaacgag---ac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
4092265 |
agatctttgaatctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaactagcacat |
4092166 |
T |
|
| Q |
120 |
aagtgttaaacacactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092165 |
aagtgttaaacaaactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
4092087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 120 - 198
Target Start/End: Complemental strand, 4086605 - 4086527
Alignment:
| Q |
120 |
aagtgttaaacacactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4086605 |
aagtgttaaacacactgtgatatcagttgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
4086527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University