View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_59 (Length: 310)
Name: NF6021_high_59
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 12 - 300
Target Start/End: Complemental strand, 26845912 - 26845624
Alignment:
| Q |
12 |
tgtaagtgcgtgctatttctactacattgggatctgatgaattatgggcgtttggtgtgagattttgcatcatggatcagagagaacagctaagatttgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26845912 |
tgtaagtgcgtgctatttctactacattgggatctgatgaattatgggcgtttggtgtgagattttgcatcatggatcagagagaacagctaagatttgg |
26845813 |
T |
 |
| Q |
112 |
tcagagatgagtatttagtgtgttatctgactttcagaaaaatttggatgagtgccattacaagacctatttattttctgactctctccatgtgtgattc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26845812 |
tcagagatgagtatttagtgtgttatctgactttcagaaaaatttggatgagtgccattacaagacctatttattttctgactctctccatgtgtgattc |
26845713 |
T |
 |
| Q |
212 |
tctttctatgagtaaagagggagtgagcaagttggttctgagggttattgctctgtttatttatagtgaaagctttcacactctctgtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26845712 |
tctttctatgagtaaagagggagtgagcaagttggttctgagggttattgctctgtttatttatagtgaaagctttcacactctctgtg |
26845624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University