View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_61 (Length: 300)
Name: NF6021_high_61
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_61 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 52396358 - 52396663
Alignment:
| Q |
1 |
aaacctgagtgaagatgaagcgttagca---ccgtcgtcttcttcaagaacttcttctttgatatgaattgcgtgagaagctgtagcaccttc---ttct |
94 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52396358 |
aaacctgagtgaagatgaagcgtgagcagcaccgtcgtcttcttcaagaacttcttctttgatatgaattgcgtgagaagctgtagcaccttcttcttct |
52396457 |
T |
 |
| Q |
95 |
tcttcggtaagtactgattcttttctttcggttgaaacgtcgtcgtaggtgtaagagctggaatttgcactgtcattgaataactctggttttattgatg |
194 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396458 |
tcttcggttagtactgattcttttctttcggttgaaacgtcgtcgtaggtgtaagagctggaatttgcactgtcattgaataactctggttttattgatg |
52396557 |
T |
 |
| Q |
195 |
ggattagacgagaattgtagccaccgatttcaccgtcgtaaccaccgtgtgctaccgccattttatttctttgtttattgggttattcggcgttactctg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396558 |
ggattagacgagaattgtagccaccgatttcaccgtcgtaaccaccgtgtgctaccgccattttatttctttgtttattgggttattcggcgttactctg |
52396657 |
T |
 |
| Q |
295 |
ttttgc |
300 |
Q |
| |
|
|||||| |
|
|
| T |
52396658 |
ttttgc |
52396663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University