View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6021_high_65 (Length: 285)
Name: NF6021_high_65
Description: NF6021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6021_high_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 35859996 - 35859741
Alignment:
| Q |
17 |
atgaacggttgtgattgctgtggagggttcagatttgttgtgtgtgatgagtgtaacggaagtcacaaagtgtatacggagaagaacggatttagaagct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
35859996 |
atgaacggttgtgattgctgtggagggttcagattcgttgtgtgtgatgagtgtaacggaagtcacaaagtgtatacggagaaaaacgggtttagaagct |
35859897 |
T |
|
| Q |
117 |
gtttgggttgtaatgttaatggtttgattaggtgccctgcatgtttcttcatgctgccgcgatacaccagatagtttgcttagttttgaagttagtttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35859896 |
gtttgggttgtaatgttaatggtttgattaggtgccctgcatgtttcttcatgctgccgcgatacaccagatagtttgcttagttttgaagttagtttta |
35859797 |
T |
|
| Q |
217 |
cagctcataaacaactggaaaagnnnnnnnnnntcatatatcttatatgatgattt |
272 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35859796 |
cagctcataaacaactggaaaagaaaaaaaaaatcatatatcttatatgatgattt |
35859741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University